Simulate an alignment#
Section author: Gavin Huttley
For this example we just create a simple model using a four taxon tree with different branch lengths and a Felsenstein model.
import sys
from cogent3 import make_tree
from cogent3.evolve.models import get_model
Specify the 4 taxon tree,
t = make_tree("(a:0.4,b:0.3,(c:0.15,d:0.2)edge.0:0.1);")
Define our Felsenstein 1981 substitution model.
sm = get_model("F81")
lf = sm.make_likelihood_function(t)
lf.set_constant_lengths()
lf.set_motif_probs(dict(A=0.1, C=0.2, G=0.3, T=0.4))
lf
F81
number of free parameters = 0
edge | parent | length |
---|---|---|
a | root | 0.4000 |
b | root | 0.3000 |
c | edge.0 | 0.1500 |
d | edge.0 | 0.2000 |
edge.0 | root | 0.1000 |
A | C | G | T |
---|---|---|---|
0.1000 | 0.2000 | 0.3000 | 0.4000 |
We’ll now create a simulated alignment of length 1000 nucleotides.
simulated = lf.simulate_alignment(sequence_length=1000)
simulated
0 | |
a | TTTTGCACGTGCGAATTAATGGATCGTGTGAATTGCTGTTTCCTTGGCTGGCACCTCCTG |
b | G.G..G....TT.T.G..GG.CCG..CTGT...AC..T.GGTTAGT......T.T..T.C |
c | G.G..G..CGTG.T.G..GG.C.G...TCTTC.CC..T.CATT......T.TT....T.C |
d | .CGGCGG.C.TT.G.GC.G....G...T.TT.ACT..T.CATT.....G..TT..AG.CC |
4 x 1000 (truncated to 4 x 60) dna alignment